{"id":19155,"date":"2026-06-23T14:03:24","date_gmt":"2026-06-23T13:03:24","guid":{"rendered":"https:\/\/internationaljournalofmicrobialscience.com\/?page_id=19155"},"modified":"2026-06-23T14:33:15","modified_gmt":"2026-06-23T13:33:15","slug":"full-text-73","status":"publish","type":"page","link":"https:\/\/internationaljournalofmicrobialscience.com\/index.php\/full-text-73\/","title":{"rendered":"Full Text:"},"content":{"rendered":"<p>&nbsp;<\/p>\n<ol>\n<li><span style=\"color: #000000;\"><strong>Introduction: <\/strong><\/span><\/li>\n<\/ol>\n<p><span style=\"color: #000000;\">\u00a0\u00a0\u00a0\u00a0 Microorganisms play a vital role in degrading the contaminants in polluted soils. As indispensable members of soil ecosystem, microorganisms drive the biochemical breakdown and synthesis of these microbial communities are central to sustaining nutrient cycling and enhancing soil fertility through successive stages [1]. The efficacy of this process stems from the evolutionary adaptability of microorganisms to shifting environments and generally known as the primary drivers of pollution [1].<\/span><br \/>\n<span style=\"color: #000000;\">\u00a0 \u00a0 \u00a0 Contaminants and xenobiotic are discharged into the environment by commercial, agricultural activities or inappropriate storage. Hence, contaminants in soil are one of the major concerns in the environment. These Xenobiotic or recalcitrant compounds did not get degraded by bacteria present in soil. If these compounds did not get degrade, they cause soil pollution lead to imbalance of ecosystem [2].<\/span><br \/>\n<span style=\"color: #000000;\">\u00a0 \u00a0 \u00a0Soil associated microorganisms also exhibit in high heterogeneity making it difficult for cultivating them in laboratory. Some bacterial taxa arising from the soil environment may exhibit in relatively slow growth rates or require complex source and develop bacterial taxa originating insights by the specific nutrient supply, such as when bacteria exhibit interdependent nutrients relationship in their natural soil environment [3]. Over 33% of major bacterial lineages are solely identified via rRNA sequence data &amp; represented exclusively by environmental molecular signatures because they are highly unknown for uncharacterized taxa and microbial dark matter constituents of significant source of biochemical and metabolic profiles [4].<\/span><br \/>\n<span style=\"color: #000000;\">For sequence alignment and taxonomic classification the full length 16S rRNA gene (1,500bp) is sufficiently large [5]. However, nearly full length of 16S rRNA gene from numerous bacterial genera can be amplified using just one pair of primer through partial sequencing (500bp), the other primers are effective for abundance of distinct sequences [6]. For instance, using this gene sequencing method has revealed notably view of broad range of microorganisms and their groups in soil or ecological conditions [7].<\/span><br \/>\n<span style=\"color: #000000;\">\u00a0 \u00a0 \u00a0 In this study, we identified that the soil present in Malshiras Village contains uncultured bacterium by cultured based technique through isolating uncountable colonies and using 16sRNA sequencing gene marker. Many less research has been done on the role of uncultured bacteria in contaminated soil, hence, this research has been undertaken. This work provides insights into\u00a0 microbial diversity of uncultured bacteria in contaminated soil and establishes a foundation for future bioremediation research.<\/span><\/p>\n<ol start=\"2\">\n<li><span style=\"color: #000000;\"><strong> Materials and Methods:<br \/>\n<\/strong><strong>2.1 Sample collection and processing<br \/>\n<\/strong>\u00a0 \u00a0 \u00a0 \u00a0Soil sample was collected from slightly contaminated site of Malshiras Village, Purandar taluka, Pune district, Maharashtra, India. Then, it was aseptically transferred to laboratory of Jayawantrao Sawant Commerce and Science college, Pune, Maharashtra, India and stored at 4<sup>0<\/sup>C in refrigerator. For serial dilution, an initial amount of soil suspension is diluted to reduce the number of microbes present in soil samples [8]. A measured volume of the diluted sample was spread onto solidified nutrient agar medium and incubated plates for 24 hours at room temperature to allow the growth of isolated colonies of microbes present in sample (figure 1).<\/span><br \/>\n<span style=\"color: #000000;\">\u00a0 \u00a0 \u00a0The isolated colonies are picked and streaked onto fresh nutrient agar slants until a pure culture was obtained [9]. The pure culture was submitted to Pro Genome Life Science Pvt. Limited, Chhatrapati Sambhajinagar, Maharashtra, India for further molecular identification through 16S rRNA Gene marker by partial sequencing (figure 2).<\/span><\/li>\n<\/ol>\n<p><span style=\"color: #000000;\"><strong>2.2 Molecular identification<\/strong><\/span><\/p>\n<p><span style=\"color: #000000;\"><strong>2.2.1 DNA Extraction and PCR amplifications<br \/>\n<\/strong>\u00a0 \u00a0 \u00a0The genomic DNA of the bacterial isolate was extracted by ProGenome Life Science by DNA Extraction kit (In House Microbial Kit) following manufactures manual instructions. The quality of isolate was verified by 1% of concentration agarose gel electrophoresis [10].The resulting DNA was observed on gel and noted using the Vilber documenting system [11].<\/span><br \/>\n<span style=\"color: #000000;\">\u00a0 \u00a0 \u00a0The fragments of isolate\u2018s 16S rRNA gene amplified by the universal primer such as 27 forward primer (AGAGTTTGATCCTGGCTCAG) and 1492 reverse primer (GGTTACCTTGTTACGACTT) [12]. After resolved on 1.2% agarose gel, the single band of distinct PCR amplicons was obtained at 52<sup>0<\/sup>C (figure 3) [11]. The PCR reaction composition consists of HiPCR\u00ae Master Mix 12.5 \u03bcl, the forward 1.5 \u03bcl and DNA template of 3.0 \u03bcl and nuclease free water 6.5 \u03bcl (table.2) for 16S rRNA gene amplification.<\/span><\/p>\n<p><span style=\"color: #000000;\"><strong>2.2.2 Cycle sequencing and purification<\/strong><\/span><\/p>\n<p><span style=\"color: #000000;\">\u00a0\u00a0\u00a0\u00a0 The Big Dye Terminator V.3.1 Cycle Sequencing Kit (Applied Bio systems, Inclusions) was implemented for the cycle sequencing reaction by subsequent purification of exonuclease-I and Shrimp Alkaline Phosphatase enzymes to eliminate unincorporated DNA strands and leftover primers [13]. The conditions for thermal cycle were 35 cycles of 30 seconds at 96<sup>0<\/sup>C, 15 seconds at 55<sup>0<\/sup>C, and 4 HiDi formamide, and bidirectional sequenced in ABI 3730 Genetic analyzer [14].<\/span><\/p>\n<p><span style=\"color: #000000;\"><strong>2.2.3 Sequence alignment and assembly phylogenetic analysis<\/strong><\/span><\/p>\n<p><span style=\"color: #000000;\">\u00a0\u00a0\u00a0\u00a0 The PRISM 3730\u00d7I Genetic analyser (Applied Bio systems, USA) was used to process the PCR products for direct bi-directional sequencing. CLUSTAL W in MEGA 11 was used to align the resultant DNA sequence, which was then manually edited and trimmed to provide full sequence [15], [20]. The sequence similarity was then used to confirm the species. The BLASTn tool was used to perform homology searches against NCBI GenBank database<\/span> (<a href=\"https:\/\/blast.ncbi.nlm.nih.gov\/Blast.cgi)\">https:\/\/blast.ncbi.nlm.nih.gov\/Blast.cgi)<\/a>. <span style=\"color: #000000;\">All places with gaps and locking data information were included for examination when the phylogenetic tree was constructed with neighbour joining method [17]. 1000 bootstrap\u00a0\u00a0 re-sampling were used to compute clade supports [16],[18].<\/span><\/p>\n<ol start=\"3\">\n<li><span style=\"color: #000000;\"><strong> Results:<br \/>\n<\/strong>\u00a0 \u00a0 \u00a0 The present study conducted on identification of uncultured bacterium present in the contaminated soil by using culture base technique and molecular identification 16S rRNA gene sequencing.<\/span><\/li>\n<\/ol>\n<p><span style=\"color: #000000;\"><strong>3.1 Isolation, sample preparation by cultured based technique<br \/>\n<\/strong>\u00a0 \u00a0Isolated colonies were observed on nutrient agar plate after incubation at 37<sup>0<\/sup>C for 24 hours (figure 1). Distinct colonies were picked and streaked onto nutrient agar slants. Pure culture was obtained with uncountable colonies of bacteria after incubation at 37<sup>0<\/sup>C for 24 to 48 hours (Figure 2).<\/span><br \/>\n<span style=\"color: #000000;\">\u00a0 \u00a0 \u00a0The amplification of the 16S rRNA region of the bacterial consortia by using (forward and reverse primers; table 1). The PCR amplification of 16S rRNA gene was successfully done for identification of\u00a0\u00a0 uncultured bacterium (RSGO1 Sample). A single identifiable band at about 1500 base pair found by gel electrophoresis was in line with targeted region&#8217;s anticipated size. There was no primer dimer or general amplification observed.<\/span><br \/>\n<span style=\"color: #000000;\">\u00a0 \u00a0 \u00a0 By using Bio edit software, the consensus sequence was generated from forward and reverse sequence data in fasta.According to NCBI gene bank database, the matrix showed 1096 maximum score, 100% query coverage, 0.0 E-value (table 2).<\/span><br \/>\n<span style=\"color: #000000;\">\u00a0 \u00a0 The neighbor joining approach was used to deduce evolutionary history. The evolutionary history of\u00a0\u00a0 bacterial taxa under study was assumed to be represented by the bootstraps consensus tree which was derived from 1000 replicates. Partitions that were replicated in less than 50% of bootstrap replicates were collapsed.<\/span><br \/>\n<span style=\"color: #000000;\">\u00a0 \u00a0 \u00a0 The Kimura 2 parameter technique was used to calculate the evolutionary distances which were expressed in terms of number of base pair substitution per site. In this investigation, 12 nucleotides sequence was involved. For all base pair sequences, ambiguous positions were eliminated (pairwise deletion options). In the final dataset, there were 1483 positions. MEGA 11 was used to carry out evolutionary studies<strong>.<\/strong><\/span><\/p>\n<ol start=\"4\">\n<li><span style=\"color: #000000;\"><strong> Discussion:<\/strong><\/span><\/li>\n<\/ol>\n<p><span style=\"color: #000000;\">\u00a0\u00a0\u00a0 Microbial examination of polluted soil samples isolated from Malshiras village, Bhuleshwar Nagar, Purandar Taluka, Pune District resulted in the isolation and culture of bacterial strains in the laboratory by cultured based technique and identification through partial 16S rRNA gene sequencing.<\/span><br \/>\n<span style=\"color: #000000;\">\u00a0 \u00a0 \u00a0Molecular evaluation revealed that this isolate showed substantial sequence similarity to bacterial taxa that have previously been reported as uncultured or poorly documented in public databases. The presence of these bacterial taxa in polluted soils may be connected with local environmental variables, including farming practices and anthropogenic factors [21] [22]. Environmental stressors can influence microbial community composition by favoring species capable of adapting to specific ecological niches [23].<\/span><br \/>\n<span style=\"color: #000000;\">\u00a0 \u00a0 \u00a0The fact that these isolates are most common in slightly polluted soils suggests that they may be important for the environment. These organisms might have metabolic pathways engaged in breakdown processes that were previously unknown as these soil microbes may have key roles in organic matter breakdown, nitrogen cycling, and maintenance [24]. Enzymes produced from uncultured soil bacteria often exhibit structural traits linked with adaptability to certain environmental circumstances, suggesting their role in ecosystem functioning and pollutant transformation [25].<\/span><br \/>\n<span style=\"color: #000000;\">\u00a0 \u00a0 \u00a0 The successful cultivation and identification through partial 16S rRNA of isolates related to previously uncultured species constitutes a crucial step toward understanding their ecological functions and physiological properties [26]. However, this finding recommends further metagenomic studies and biochemical research is required to demonstrate their unique metabolic abilities management.<\/span><\/p>\n<p><span style=\"color: #000000;\"><strong>5<\/strong><strong>.Conclusion:<br \/>\n<\/strong>\u00a0 \u00a0 \u00a0 \u00a0This study investigated that the contaminated soil of Malshiras Village, Purandar region consists of uncultured bacterium identified by 16S rRNA gene sequencing method<strong><em>.<\/em><\/strong><\/span><\/p>\n<p>&nbsp;<\/p>\n<p>&nbsp;<\/p>\n","protected":false},"excerpt":{"rendered":"<p>&nbsp; Introduction: \u00a0\u00a0\u00a0\u00a0 Microorganisms play a vital role in degrading the contaminants in polluted soils&#8230;.<\/p>\n","protected":false},"author":1,"featured_media":0,"parent":0,"menu_order":0,"comment_status":"closed","ping_status":"closed","template":"","meta":{"footnotes":""},"aioseo_notices":[],"_links":{"self":[{"href":"https:\/\/internationaljournalofmicrobialscience.com\/index.php\/wp-json\/wp\/v2\/pages\/19155"}],"collection":[{"href":"https:\/\/internationaljournalofmicrobialscience.com\/index.php\/wp-json\/wp\/v2\/pages"}],"about":[{"href":"https:\/\/internationaljournalofmicrobialscience.com\/index.php\/wp-json\/wp\/v2\/types\/page"}],"author":[{"embeddable":true,"href":"https:\/\/internationaljournalofmicrobialscience.com\/index.php\/wp-json\/wp\/v2\/users\/1"}],"replies":[{"embeddable":true,"href":"https:\/\/internationaljournalofmicrobialscience.com\/index.php\/wp-json\/wp\/v2\/comments?post=19155"}],"version-history":[{"count":1,"href":"https:\/\/internationaljournalofmicrobialscience.com\/index.php\/wp-json\/wp\/v2\/pages\/19155\/revisions"}],"predecessor-version":[{"id":19156,"href":"https:\/\/internationaljournalofmicrobialscience.com\/index.php\/wp-json\/wp\/v2\/pages\/19155\/revisions\/19156"}],"wp:attachment":[{"href":"https:\/\/internationaljournalofmicrobialscience.com\/index.php\/wp-json\/wp\/v2\/media?parent=19155"}],"curies":[{"name":"wp","href":"https:\/\/api.w.org\/{rel}","templated":true}]}}